| Name |
Consensus motif |
Author |
Title |
Reference |
| ABFs binding site motif |
CACGTGGC |
Guiltinan MJ, Marcotte WR Jr, Quatrano RS. |
A plant leucine zipper protein that recognizes an abscisic acid response element |
Science 250:267-270 (1990) |
| ABRE binding site motif |
(C/T)ACGTGGC |
Choi H, Hong J, Ha J, Kang J, Kim SY |
ABFs, a family of ABA-responsive element binding factors |
J Biol Chem. 275: 1723-1730 (2000) |
| ABRE-like binding site motif |
(C/G/T)ACGTG(G/T)(A/C) |
Shinozaki K., Yamaguchi-Shinozaki K. |
Molecular responses to dehydration and low temperature |
Curr. Opin. Plant Biol. (2000) 3:217-223 |
| ACE promoter motif |
GACACGTAGA |
Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B |
Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system |
Plant Mol Biol (1998) 36: 741-754 |
| AG binding site motif |
TT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG(A/C/T) |
Shiraishi H, Okada K, Shimura Y |
Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis thaliana in vitro |
Plant J 4: 385-398 (1993) |
| AG BS in AP3 |
CCATTTTTAGT |
Tilly J. J., Allen D. W., Jack T. |
The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects |
Development 125:1647-1657 (1998) |
| AG BS in SUP |
CCATTTTTGG |
Riechmann J. L., Krizek B. A., Meyerowitz E. M. |
Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS |
Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996) |
| AGL1 binding site motif |
NTT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)NNGG(A/T)AAN |
Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H |
DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation |
Plant Cell 8: 81-94 (1996) |
| AGL2 binding site motif |
NN(A/T)NCCA(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)(A/T)AN |
Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H |
DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation |
Plant Cell 8: 81-94 (1996) |
| AGL3 binding site motif |
TT(A/T)C(C/T)A(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)AA |
Huang H, Tudor M, Weiss CA, Hu Y, Ma H |
The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein |
Plant Mol Biol 28:549-567 (1995) |
| AP1 BS in AP3 |
CCATTTTTAG |
Tilly J. J., Allen D. W., Jack T. |
The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects |
Development 125:1647-1657 (1998) |
| AP1 BS in SUP |
CCATTTTTGG |
Riechmann J. L., Krizek B. A., Meyerowitz E. M. |
Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS |
Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996). |
| ARF binding site motif |
TGTCTC |
Ulmasov T, Hagen G, Guilfoyle TJ |
Dimerization and DNA binding of auxin response factors |
Plant J 19:309-319 (1999) |
| ARF1 binding site motif |
TGTCTC |
Ulmasov T, Hagen G, Guilfoyle TJ |
Dimerization and DNA binding of auxin response factors |
Plant J 19:309-319 (1999) |
| ATHB1 binding site motif |
CAAT(A/T)ATTG |
Sessa G, Morelli G, Ruberti I |
The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities |
EMBO J 12:3507-3517 (1993) |
| ATHB2 binding site motif |
CAAT(C/G)ATTG |
Sessa G, Morelli G, Ruberti I |
The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities |
EMBO J 12:3507-3517 (1993) |
| ATHB5 binding site motif |
CAATNATTG |
Johannesson H, Wang Y, Engstrom P. |
DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro |
Plant Mol Biol 45: 63-73 (2001) |
| ATHB6 binding site motif |
CAATTATTA |
Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E. |
Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis |
EMBO J. 21:3029-3038 (2002) |
| AtMYB2 BS in RD22 |
CTAACCA |
Shinozaki K |
Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. |
Plant Cell 9:1859-1868 (1997) |
| AtMYC2 BS in RD22 |
CACATG |
Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K |
Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. |
Plant Cell 9:1859-1868 (1997) |
| Box II promoter motif |
GGTTAA |
Le Gourrierec J, Li YF, Zhou DX. |
Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex |
Plant J. 1999 Jun;18(6):663-8. |
| CArG promoter motif |
CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG |
Hepworth SR, Valverde F, Ravenscroft D, Mouradov A, Coupland G. |
Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs |
EMBO J. 21: 4327-4337 (2002) |
| CArG1 motif in AP3 |
GTTTACATAAATGGAAAA |
Tilly JJ, Allen DW, Jack T. |
The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. |
Development. 1998 May;125(9):1647-57 |
| CArG2 motif in AP3 |
CTTACCTTTCATGGATTA |
Tilly JJ, Allen DW, Jack T. |
The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. |
Development. 1998 May;125(9):1647-57 |
| CArG3 motif in AP3 |
CTTTCCATTTTTAGTAAC |
Tilly JJ, Allen DW, Jack T. |
The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. |
Development. 1998 May;125(9):1647-57 |
| CBF1 BS in cor15a |
TGGCCGAC |
Hao D, Yamasaki K, Sarai A, Ohme-Takagi M. |
Determinants in the sequence specific binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs. |
Biochemistry. 2002 Apr 2;41(13):4202-8 |
| CBF2 binding site motif |
CCACGTGG |
Pla M, Vilardell J, Guiltinan MJ, Marcotte WR, Niogret MF, Quatrano RS, Pages M |
The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28. |
Plant Mol Biol 21:259-266 (1993) |
| CCA1 binding site motif |
AA(A/C)AATCT |
Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM. |
A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene |
Plant cell 9:491-507 (1997) |
| CCA1 motif1 BS in CAB1 |
AAACAATCTA |
Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM |
A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. |
Plant cell 9:491-507 (1997) |
| CCA1 motif2 BS in CAB1 |
AAAAAAAATCTATGA |
Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM |
A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. |
Plant cell 9:491-507 (1997) |
| DPBF1&2 binding site motif |
ACACNNG |
Kim SY, Chung HJ, Thomas TL. |
Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system |
Plant J 11: 1237-1251 (1997) |
| DRE promoter motif |
TACCGACAT |
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K |
Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor |
Nat Biotechnol 17: 287-291 (1999) |
| DREB1&2 BS in rd29a |
TACCGACAT |
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K |
Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor |
Nat Biotechnol 17: 287-291 (1999) |
| DRE-like promoter motif |
(A/G/T)(A/G)CCGACN(A/T) |
Chen W., Provart N. et al. |
The Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses |
Plant Cell (2002) 14:559-574 |
| E2F binding site motif |
TTTCCCGC |
Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N. |
Cell cycle regulation of the tobacco ribonucleotide reductase small subunit gene is mediated by E2F-like elements |
Plant Cell 12: 1987-2000 (2000) |
| E2F/DP BS in AtCDC6 |
TTTCCCGC |
de Jager SM, Menges M, Bauer UM, Murra JA. |
Arabidopsis E2F1 binds a sequence present in the promoter of S-phase-regulated gene AtCDC6 and is a member of a multigene family with differential activities. |
Plant Mol Biol. 2001 Nov;47(4):555-68. |
| E2F-varient binding site motif |
TCTCCCGCC |
Ramirez-Parra E, Frundt C, Gutierrez C. |
A genome-wide identification of E2F-regulated genes in Arabidopsis |
Plant J. 2003 Feb;33(4):801-11. |
| EIL1 BS in ERF1 |
TTCAAGGGGGCATGTATCTTGAA |
Solano R., Stepanova A., Chao Q., Ecker J. R. |
Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 |
Genes Dev. 12:3703-3714 (1998) |
| EIL2 BS in ERF1 |
TTCAAGGGGGCATGTATCTTGAA |
Solano R., Stepanova A., Chao Q., Ecker J. R. |
Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 |
Genes Dev. 12:3703-3714 (1998). |
| EIL3 BS in ERF1 |
TTCAAGGGGGCATGTATCTTGAA |
Solano R., Stepanova A., Chao Q., Ecker J. R. |
Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 |
Genes Dev. 12:3703-3714 (1998). |
| EIN3 BS in ERF1 |
GGATTCAAGGGGGCATGTATCTTGAATCC |
Solano R, Stepanova A, Chao Q, Ecker JR |
Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 |
Genes Dev. 12: 3703-3714 (1998). |
| ERE promoter motif |
TAAGAGCCGCC |
Shinshi H, Usami S, Ohme-Takagi M. |
Identification of an ethylene-responsive region in the promoter of a tobacco class I chitinase gene |
Plant Mol Biol 27:923-932 (1995) |
| ERF1 BS in AtCHI-B |
GCCGCC |
Solano R., Stepanova A., Chao Q., Ecker J. R. |
Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 |
Genes Dev. 12:3703-3714 (1998) |
| EveningElement promoter motif |
AAAATATCT |
Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA. |
Orchestrated transcription of key pathways in Arabidopsis by the circadian clock |
Science 290: 2110-3 (2000) |
| GATA promoter motif |
(A/T)GATA(G/A) |
Teakle GR, Manfield IW, Graham JF, Gilmartin PM. |
Arabidopsis thaliana GATA factors: organisation, expression and DNA-binding characteristics |
Plant Mol Biol. 2002 Sep;50(1):43-57. |
| GBF1/2/3 BS in ADH1 |
CCACGTGG |
de Vetten N. C., Ferl R. J. |
Characterization of a maize G-box binding factor that is induced by hypoxia |
Plant J. 7:589-601 (1995). |
| G-box promoter motif |
CACGTG |
Menkens AE, Cashmore AR. |
Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein |
Proc Natl Acad Sci USA 91: 2522-2526 (1994) |
| GCC-box promoter motif |
GCCGCC |
Shinozaki K., Yamaguchi-Shinozaki K. |
Molecular responses to dehydration and low temperature |
Curr. Opin. Plant Biol. 3:217-223 |
| GT promoter motif |
TGTGTGGTTAATATG |
Green PJ, Kay SA, Chua N-H. |
Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene. |
EMBO J 6:2543-2549 (1987) |
| Hexamer promoter motif |
CCGTCG |
Chaubet N, Flenet M, Clement B, Brignon P, Gigot C. |
Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene |
Plant J 10:425-435 (1996) |
| HSEs binding site motif |
AGAANNTTCT |
Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD. |
Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need? |
Cell Stress Chaperones. 2001 Jul;6(3):177-89. Review. |
| Ibox promoter motif |
GATAAG |
Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR. |
An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene |
Proc Natl Acad Sci USA 85:7089-7093 (1988) |
| JASE1 motif in OPR1 |
CGTCAATGAA |
He Y, Gan S |
Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis |
Plant Mol Biol 47: 595-605 (2001) |
| JASE2 motif in OPR2 |
CATACGTCGTCAA |
He Y, Gan S |
Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis |
Plant Mol Biol 47: 595-605 (2001) |
| L1-box promoter motif |
TAAATG(C/T)A |
Abe M, Takahashi T, Komeda Y. |
Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein |
Plant J 26: 487-494 (2001) |
| LS5 promoter motif |
ACGTCATAGA |
Despres C, DeLong C, Glaze S, Liu E, Fobert PR |
The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors |
Plant Cell 12: 279-290 (2000) |
| LS7 promoter motif |
TCTACGTCAC |
Despres C, DeLong C, Glaze S, Liu E, Fobert PR |
The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors |
Plant Cell 12: 279-290 (2000) |
| LTRE promoter motif |
ACCGACA |
Nordin K, Vahala T, Palva ET. |
Differential expression of two related, low-temperature-induced genes in Arabidopsis thaliana (L.) Heynh |
Plant Mol Biol 21:641-653 (1993) |
| MRE motif in CHS |
TCTAACCTACCA |
Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B |
Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system |
Plant Mol Biol (1998) 36: 741-754 |
| MYB binding site promoter |
(A/C)ACC(A/T)A(A/C)C |
Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M. |
A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes |
EMBO J 13:128-137 (1994) |
| MYB1 binding site motif |
(A/C)TCC(A/T)ACC |
Menkens AE, Cashmore AR. |
Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein |
Proc Natl Acad Sci USA 91: 2522-2526 (1994) |
| MYB2 binding site motif |
TAACT(G/C)GTT |
Martin C, Paz-Ares J. |
MYB transcription factors in plants |
Trends Genet. 13:67-73 (1997) |
| MYB3 binding site motif |
TAACTAAC |
Chen W., Provart N. et al. |
Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. |
Plant Cell. 2002 Mar;14(3):559-74. |
| MYB4 binding site motif |
A(A/C)C(A/T)A(A/C)C |
Chen W., Provart N. et al. |
Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. |
Plant Cell. 2002 Mar;14(3):559-74. |
| Nonamer promoter motif |
AGATCGACG |
Chaubet N, Flenet M, Clement B, Brignon P, Gigot C. |
Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene |
Plant J 10:425-435 (1996) |
| OBF4,5 BS in GST6 |
ATCTTATGTCATTGATGACGACCTCC |
Chen W, Chao G, Singh KB |
The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites. |
Plant J 10: 955-966 (1996) |
| OBP-1,4,5 BS in GST6 |
TACACTTTTGG |
Chen W, Chao G, Singh KB |
The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding RT |
Plant J 10: 955-966 (1996) |
| OCS promoter motif |
TGACG(C/T)AAG(C/G)(A/G)(A/C)T(G/T)ACG(C/T)(A/C)(A/C) |
Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG. |
The ocs-element is a component of the promoters of several T-DNA and plant viral genes |
EMBO J 8:4197-4204 (1989). |
| octamer promoter motif |
CGCGGATC |
Chaubet N, Philipps G, Chaboute M-E, Ehling M, Giot C. |
Nucleotide sequences of two corn histone H3 genes. Genomic organization of the corn histone H3 and H4 genes |
Plant Mol Biol 6:253-263 (1986) |
| PI promoter motif |
GTGATCAC |
Chan CS, Guo L, Shih MC. |
Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana |
Plant Mol Biol 46: 131-141 (2001) |
| PII promoter motif |
TTGGTTTTGATCAAAACCAA |
Chan CS, Guo L, Shih MC. |
Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana |
Plant Mol Biol 46: 131-141 (2001) |
| PRHA BS in PAL1 |
TAATTGACTCAATTA |
Plesch G., Stoermann K., Torres J. T., Walden R., Somssich I. E. |
Developmental and auxin-induced expression of the Arabidopsis prha homeobox gene |
Plant J. 12:635-647 (1997) |
| RAV1-A binding site motif |
CAACA |
Kagaya Y, Ohmiya K, Hattori T. |
RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants |
Nucleic Acids Res 27: 470-478 (1999) |
| RAV1-B binding site motif |
CACCTG |
Kagaya Y, Ohmiya K, Hattori T. |
RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants |
Nucleic Acids Res 27: 470-478 (1999) |
| RY-repeat promoter motif |
CATGCATG |
Dickinson CD, Evans RP, Nielsen NC. |
RY repeats are conserved in the 5 prime-flanking region of legume seed protein genes |
Nucleic Acids Res 16:371 (1988) |
| SBP-box promoter motif |
TNCGTACAA |
Cardon G, Hohmann S, Klein J, Nettesheim K, Saedler H, Huijser P. |
Molecular characterisation of the Arabidopsis SBP-box genes |
Gene. 1999 Sep 3;237(1):91-104 |
| T-box promoter motif |
ACTTTG |
Chan CS, Guo L, Shih MC. |
Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana |
Plant Mol Biol 46: 131-141 (2001). |
| TEF-box promoter motif |
AGGGGCATAATGGTAA |
Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B. |
Plant interstitial telomere mitifs participate in the control of gene expression in root meristems |
Plant J 20: 553-561 (1999) |
| TELO-box promoter motif |
AAACCCTAA |
Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B. |
Plant interstitial telomere mitifs participate in the control of gene expression in root meristems |
Plant J 20: 553-561 (1999) |
| TGA1 binding site motif |
TGACGTGG |
Schindler U, Beckmann H, Cashmore AR. |
TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box-like element TGACGTGG |
Plant Cell 4: 1309-1319 (1992). |
| W-box promoter motif |
TTGAC |
Yu D, Chen C, Chen Z. |
Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression |
Plant Cell 13: 1527-1540 (2001). |
| Z-box promoter motif |
ATACGTGT |
Ha SB, An G |
Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene |
Proc Natl Acad Sci USA 85: 8017-8021 (1988) |
| AG BS in SPL/NOZ |
AAAACAGAATAGGAAA |
Ito et al. |
The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS |
Nature, 430: 356-360 (2004) |
| Bellringer/replumless/pennywise BS1 IN AG |
AAATTAAA |
Bao X, Franks RG, Levin JG, Liu Z |
Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
|
Plant Cell 16: 1478-1489 (2004) |
| Bellringer/replumless/pennywise BS2 IN AG |
AAATTAGT |
Bao X, Franks RG, Levin JG, Liu Z |
Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
|
Plant Cell 16: 1478-1489 (2004) |
| Bellringer/replumless/pennywise BS3 IN AG |
ACTAATTT |
Bao X, Franks RG, Levin JG, Liu Z |
Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
|
Plant Cell 16: 1478-1489 (2004) |
| AGL15 BS in AtGA2ox6 |
CCAATTTAATGG |
Wang H, Caruso LV, Downie B, Perry SE |
The Embryo MADS Domain Protein AGAMOUS-LIKE15 Directly Regulates Expression of a Gene Encoding an Enzyme Involved in Gibberellin Metabolism |
Plant Cell 16: 1206-1219. (2004) |
| ATB2/AtbZIP53/AtbZIP44/GBF5 BS in ProDH |
ACTCAT |
Satoh et al |
A Novel Subgroup of bZIP Proteins Functions as Transctiptional Activators in Hypsosmolarity-Responsive Expression of the ProDH gene in Arabidopsis |
Plant Cell Physiol. 45(3):300-317. (2004) |
| LFY BS in AP3 |
CTTAAACCCTAGGGGTAAT |
Lamb RS, Hill TA, Tan QKG, Irish VF |
Regulation of APETALA3 floral homeotic gene expression by meristem identity genes |
Development 129: 2079-2086. (2002) |
| SORLREP1 |
TT[AT]TACTAGT |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLREP2 |
ATAAAACGT |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLREP3 |
TGTATATAT |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLREP4 |
CTCCTAATT |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLREP5 |
TTGCATGACT |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLIP1 |
AGCCAC |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLIP2 |
GGGCC |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLIP3 |
CTCAAGTGA |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLIP4 |
GTATGATGG |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
| SORLIP5 |
GAGTGAG |
Hudson M, Quail P |
Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. |
Plant Physiology.133. 1605–1616. (2003) |
