AGRIS logo
Home AtcisDB AtTFDB Regulatory
People Downloads External Resources Publications

Consensus motif
ABFs binding site motif CACGTGGC Guiltinan MJ, Marcotte WR Jr, Quatrano RS. A plant leucine zipper protein that recognizes an abscisic acid response element Science 250:267-270 (1990)
ABRE binding site motif (C/T)ACGTGGC Choi H, Hong J, Ha J, Kang J, Kim SY ABFs, a family of ABA-responsive element binding factors J Biol Chem. 275: 1723-1730 (2000)
ABRE-like binding site motif (C/G/T)ACGTG(G/T)(A/C) Shinozaki K., Yamaguchi-Shinozaki K. Molecular responses to dehydration and low temperature Curr. Opin. Plant Biol. (2000) 3:217-223
ACE promoter motif GACACGTAGA Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system Plant Mol Biol (1998) 36: 741-754
AG binding site motif TT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG(A/C/T) Shiraishi H, Okada K, Shimura Y Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis thaliana in vitro Plant J 4: 385-398 (1993)
AG BS in AP3 CCATTTTTAGT Tilly J. J., Allen D. W., Jack T. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects Development 125:1647-1657 (1998)
AG BS in SUP CCATTTTTGG Riechmann J. L., Krizek B. A., Meyerowitz E. M. Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996)
AGL1 binding site motif NTT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)NNGG(A/T)AAN Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation Plant Cell 8: 81-94 (1996)
AGL2 binding site motif NN(A/T)NCCA(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)(A/T)AN Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation Plant Cell 8: 81-94 (1996)
AGL3 binding site motif TT(A/T)C(C/T)A(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)AA Huang H, Tudor M, Weiss CA, Hu Y, Ma H The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein Plant Mol Biol 28:549-567 (1995)
AP1 BS in AP3 CCATTTTTAG Tilly J. J., Allen D. W., Jack T. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects Development 125:1647-1657 (1998)
AP1 BS in SUP CCATTTTTGG Riechmann J. L., Krizek B. A., Meyerowitz E. M. Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996).
ARF binding site motif TGTCTC Ulmasov T, Hagen G, Guilfoyle TJ Dimerization and DNA binding of auxin response factors Plant J 19:309-319 (1999)
ARF1 binding site motif TGTCTC Ulmasov T, Hagen G, Guilfoyle TJ Dimerization and DNA binding of auxin response factors Plant J 19:309-319 (1999)
ATHB1 binding site motif CAAT(A/T)ATTG Sessa G, Morelli G, Ruberti I The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities EMBO J 12:3507-3517 (1993)
ATHB2 binding site motif CAAT(C/G)ATTG Sessa G, Morelli G, Ruberti I The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities EMBO J 12:3507-3517 (1993)
ATHB5 binding site motif CAATNATTG Johannesson H, Wang Y, Engstrom P. DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro Plant Mol Biol 45: 63-73 (2001)
ATHB6 binding site motif CAATTATTA Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E. Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis EMBO J. 21:3029-3038 (2002)
AtMYB2 BS in RD22 CTAACCA Shinozaki K Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9:1859-1868 (1997)
AtMYC2 BS in RD22 CACATG Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9:1859-1868 (1997)
Box II promoter motif GGTTAA Le Gourrierec J, Li YF, Zhou DX. Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex Plant J. 1999 Jun;18(6):663-8.
CArG promoter motif CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG Hepworth SR, Valverde F, Ravenscroft D, Mouradov A, Coupland G. Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs EMBO J. 21: 4327-4337 (2002)
CArG1 motif in AP3 GTTTACATAAATGGAAAA Tilly JJ, Allen DW, Jack T. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development. 1998 May;125(9):1647-57
CArG2 motif in AP3 CTTACCTTTCATGGATTA Tilly JJ, Allen DW, Jack T. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development. 1998 May;125(9):1647-57
CArG3 motif in AP3 CTTTCCATTTTTAGTAAC Tilly JJ, Allen DW, Jack T. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development. 1998 May;125(9):1647-57
CBF1 BS in cor15a TGGCCGAC Hao D, Yamasaki K, Sarai A, Ohme-Takagi M. Determinants in the sequence specific binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs. Biochemistry. 2002 Apr 2;41(13):4202-8
CBF2 binding site motif CCACGTGG Pla M, Vilardell J, Guiltinan MJ, Marcotte WR, Niogret MF, Quatrano RS, Pages M The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28. Plant Mol Biol 21:259-266 (1993)
CCA1 binding site motif AA(A/C)AATCT Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM. A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene Plant cell 9:491-507 (1997)
CCA1 motif1 BS in CAB1 AAACAATCTA Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. Plant cell 9:491-507 (1997)
CCA1 motif2 BS in CAB1 AAAAAAAATCTATGA Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. Plant cell 9:491-507 (1997)
DPBF1&2 binding site motif ACACNNG Kim SY, Chung HJ, Thomas TL. Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system Plant J 11: 1237-1251 (1997)
DRE promoter motif TACCGACAT Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor Nat Biotechnol 17: 287-291 (1999)
DREB1&2 BS in rd29a TACCGACAT Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor Nat Biotechnol 17: 287-291 (1999)
DRE-like promoter motif (A/G/T)(A/G)CCGACN(A/T) Chen W., Provart N. et al. The Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses Plant Cell (2002) 14:559-574
E2F binding site motif TTTCCCGC Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N. Cell cycle regulation of the tobacco ribonucleotide reductase small subunit gene is mediated by E2F-like elements Plant Cell 12: 1987-2000 (2000)
E2F/DP BS in AtCDC6 TTTCCCGC de Jager SM, Menges M, Bauer UM, Murra JA. Arabidopsis E2F1 binds a sequence present in the promoter of S-phase-regulated gene AtCDC6 and is a member of a multigene family with differential activities. Plant Mol Biol. 2001 Nov;47(4):555-68.
E2F-varient binding site motif TCTCCCGCC Ramirez-Parra E, Frundt C, Gutierrez C. A genome-wide identification of E2F-regulated genes in Arabidopsis Plant J. 2003 Feb;33(4):801-11.
EIL1 BS in ERF1 TTCAAGGGGGCATGTATCTTGAA Solano R., Stepanova A., Chao Q., Ecker J. R. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 Genes Dev. 12:3703-3714 (1998)
EIL2 BS in ERF1 TTCAAGGGGGCATGTATCTTGAA Solano R., Stepanova A., Chao Q., Ecker J. R. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 Genes Dev. 12:3703-3714 (1998).
EIL3 BS in ERF1 TTCAAGGGGGCATGTATCTTGAA Solano R., Stepanova A., Chao Q., Ecker J. R. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 Genes Dev. 12:3703-3714 (1998).
EIN3 BS in ERF1 GGATTCAAGGGGGCATGTATCTTGAATCC Solano R, Stepanova A, Chao Q, Ecker JR Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 Genes Dev. 12: 3703-3714 (1998).
ERE promoter motif TAAGAGCCGCC Shinshi H, Usami S, Ohme-Takagi M. Identification of an ethylene-responsive region in the promoter of a tobacco class I chitinase gene Plant Mol Biol 27:923-932 (1995)
ERF1 BS in AtCHI-B GCCGCC Solano R., Stepanova A., Chao Q., Ecker J. R. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1 Genes Dev. 12:3703-3714 (1998)
EveningElement promoter motif AAAATATCT Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA. Orchestrated transcription of key pathways in Arabidopsis by the circadian clock Science 290: 2110-3 (2000)
GATA promoter motif (A/T)GATA(G/A) Teakle GR, Manfield IW, Graham JF, Gilmartin PM. Arabidopsis thaliana GATA factors: organisation, expression and DNA-binding characteristics Plant Mol Biol. 2002 Sep;50(1):43-57.
GBF1/2/3 BS in ADH1 CCACGTGG de Vetten N. C., Ferl R. J. Characterization of a maize G-box binding factor that is induced by hypoxia Plant J. 7:589-601 (1995).
G-box promoter motif CACGTG Menkens AE, Cashmore AR. Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein Proc Natl Acad Sci USA 91: 2522-2526 (1994)
GCC-box promoter motif GCCGCC Shinozaki K., Yamaguchi-Shinozaki K. Molecular responses to dehydration and low temperature Curr. Opin. Plant Biol. 3:217-223
GT promoter motif TGTGTGGTTAATATG Green PJ, Kay SA, Chua N-H. Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene. EMBO J 6:2543-2549 (1987)
Hexamer promoter motif CCGTCG Chaubet N, Flenet M, Clement B, Brignon P, Gigot C. Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene Plant J 10:425-435 (1996)
HSEs binding site motif AGAANNTTCT Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD. Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need? Cell Stress Chaperones. 2001 Jul;6(3):177-89. Review.
Ibox promoter motif GATAAG Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR. An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene Proc Natl Acad Sci USA 85:7089-7093 (1988)
JASE1 motif in OPR1 CGTCAATGAA He Y, Gan S Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis Plant Mol Biol 47: 595-605 (2001)
JASE2 motif in OPR2 CATACGTCGTCAA He Y, Gan S Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis Plant Mol Biol 47: 595-605 (2001)
L1-box promoter motif TAAATG(C/T)A Abe M, Takahashi T, Komeda Y. Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein Plant J 26: 487-494 (2001)
LS5 promoter motif ACGTCATAGA Despres C, DeLong C, Glaze S, Liu E, Fobert PR The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors Plant Cell 12: 279-290 (2000)
LS7 promoter motif TCTACGTCAC Despres C, DeLong C, Glaze S, Liu E, Fobert PR The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors Plant Cell 12: 279-290 (2000)
LTRE promoter motif ACCGACA Nordin K, Vahala T, Palva ET. Differential expression of two related, low-temperature-induced genes in Arabidopsis thaliana (L.) Heynh Plant Mol Biol 21:641-653 (1993)
MRE motif in CHS TCTAACCTACCA Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system Plant Mol Biol (1998) 36: 741-754
MYB binding site promoter (A/C)ACC(A/T)A(A/C)C Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes EMBO J 13:128-137 (1994)
MYB1 binding site motif (A/C)TCC(A/T)ACC Menkens AE, Cashmore AR. Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein Proc Natl Acad Sci USA 91: 2522-2526 (1994)
MYB2 binding site motif TAACT(G/C)GTT Martin C, Paz-Ares J. MYB transcription factors in plants Trends Genet. 13:67-73 (1997)
MYB3 binding site motif TAACTAAC Chen W., Provart N. et al. Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. Plant Cell. 2002 Mar;14(3):559-74.
MYB4 binding site motif A(A/C)C(A/T)A(A/C)C Chen W., Provart N. et al. Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. Plant Cell. 2002 Mar;14(3):559-74.
Nonamer promoter motif AGATCGACG Chaubet N, Flenet M, Clement B, Brignon P, Gigot C. Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene Plant J 10:425-435 (1996)
OBF4,5 BS in GST6 ATCTTATGTCATTGATGACGACCTCC Chen W, Chao G, Singh KB The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites. Plant J 10: 955-966 (1996)
OBP-1,4,5 BS in GST6 TACACTTTTGG Chen W, Chao G, Singh KB The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding RT Plant J 10: 955-966 (1996)
OCS promoter motif TGACG(C/T)AAG(C/G)(A/G)(A/C)T(G/T)ACG(C/T)(A/C)(A/C) Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG. The ocs-element is a component of the promoters of several T-DNA and plant viral genes EMBO J 8:4197-4204 (1989).
octamer promoter motif CGCGGATC Chaubet N, Philipps G, Chaboute M-E, Ehling M, Giot C. Nucleotide sequences of two corn histone H3 genes. Genomic organization of the corn histone H3 and H4 genes Plant Mol Biol 6:253-263 (1986)
PI promoter motif GTGATCAC Chan CS, Guo L, Shih MC. Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001)
PII promoter motif TTGGTTTTGATCAAAACCAA Chan CS, Guo L, Shih MC. Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001)
PRHA BS in PAL1 TAATTGACTCAATTA Plesch G., Stoermann K., Torres J. T., Walden R., Somssich I. E. Developmental and auxin-induced expression of the Arabidopsis prha homeobox gene Plant J. 12:635-647 (1997)
RAV1-A binding site motif CAACA Kagaya Y, Ohmiya K, Hattori T. RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants Nucleic Acids Res 27: 470-478 (1999)
RAV1-B binding site motif CACCTG Kagaya Y, Ohmiya K, Hattori T. RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants Nucleic Acids Res 27: 470-478 (1999)
RY-repeat promoter motif CATGCATG Dickinson CD, Evans RP, Nielsen NC. RY repeats are conserved in the 5 prime-flanking region of legume seed protein genes Nucleic Acids Res 16:371 (1988)
SBP-box promoter motif TNCGTACAA Cardon G, Hohmann S, Klein J, Nettesheim K, Saedler H, Huijser P. Molecular characterisation of the Arabidopsis SBP-box genes Gene. 1999 Sep 3;237(1):91-104
T-box promoter motif ACTTTG Chan CS, Guo L, Shih MC. Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001).
TEF-box promoter motif AGGGGCATAATGGTAA Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B. Plant interstitial telomere mitifs participate in the control of gene expression in root meristems Plant J 20: 553-561 (1999)
TELO-box promoter motif AAACCCTAA Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B. Plant interstitial telomere mitifs participate in the control of gene expression in root meristems Plant J 20: 553-561 (1999)
TGA1 binding site motif TGACGTGG Schindler U, Beckmann H, Cashmore AR. TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box-like element TGACGTGG Plant Cell 4: 1309-1319 (1992).
W-box promoter motif TTGAC Yu D, Chen C, Chen Z. Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression Plant Cell 13: 1527-1540 (2001).
Z-box promoter motif ATACGTGT Ha SB, An G Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene Proc Natl Acad Sci USA 85: 8017-8021 (1988)
AG BS in SPL/NOZ AAAACAGAATAGGAAA Ito et al. The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS Nature, 430: 356-360 (2004)
Bellringer/replumless/pennywise BS1 IN AG AAATTAAA Bao X, Franks RG, Levin JG, Liu Z Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems Plant Cell 16: 1478-1489 (2004)
Bellringer/replumless/pennywise BS2 IN AG AAATTAGT Bao X, Franks RG, Levin JG, Liu Z Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems Plant Cell 16: 1478-1489 (2004)
Bellringer/replumless/pennywise BS3 IN AG ACTAATTT Bao X, Franks RG, Levin JG, Liu Z Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems Plant Cell 16: 1478-1489 (2004)
AGL15 BS in AtGA2ox6 CCAATTTAATGG Wang H, Caruso LV, Downie B, Perry SE The Embryo MADS Domain Protein AGAMOUS-LIKE15 Directly Regulates Expression of a Gene Encoding an Enzyme Involved in Gibberellin Metabolism Plant Cell 16: 1206-1219. (2004)
ATB2/AtbZIP53/AtbZIP44/GBF5 BS in ProDH ACTCAT Satoh et al A Novel Subgroup of bZIP Proteins Functions as Transctiptional Activators in Hypsosmolarity-Responsive Expression of the ProDH gene in Arabidopsis Plant Cell Physiol. 45(3):300-317. (2004)
LFY BS in AP3 CTTAAACCCTAGGGGTAAT Lamb RS, Hill TA, Tan QKG, Irish VF Regulation of APETALA3 floral homeotic gene expression by meristem identity genes Development 129: 2079-2086. (2002)
SORLREP1 TT[AT]TACTAGT Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLREP2 ATAAAACGT Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLREP3 TGTATATAT Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLREP4 CTCCTAATT Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLREP5 TTGCATGACT Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLIP1 AGCCAC Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLIP2 GGGCC Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLIP3 CTCAAGTGA Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLIP4 GTATGATGG Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)
SORLIP5 GAGTGAG Hudson M, Quail P Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology.133. 16051616. (2003)

Copyright © 2012. All rights reserved. Credits